Filters

List of ph buffer solution Tenders

List of latest ph buffer solution Tenders in Indian Tenders. Click on any ph buffer solution Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for ph buffer solution Tenders.

All-Tenders (6)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :34283872 | 18 Apr, 2025

Tender Value : 0

Ambala - Haryana

Tender for gem bids for inj bleomycin sulphate 15 units vial , hydrocortisone acetate cream 1 percent ww tube of 15 gm , cap minocycline er 65 mg , tab minoxidil 2 point 5 mg , clobetasol propionate 0 point 05 percent w w plus buffered lactic acid 12 percent w w 30 gm gel , zinc oxide and benzalkonium chloride cream tube of 30 gram , 0 point 1 percent triamcinolone acetonide bucccal parts 7 point 5 gm tube , calcium pantothenate tablet 200 mg , lot padophyllin resin 20 percent bott of 10ml , tab acetretin 10 mg , clindamycin 1 percent w v benzoyl peroxide 5 percent w w gel 20gm , cyclophosphamide 500 mg inj , lot lactic acid 17 percent plus salicylic acid 17 percent bott of 15ml , lot ciclopirox 1 percent w v zinc pyrithidone 1 percent 100ml , cyclosporine eye drops 0 point 05 percent bott of 3 ml , ketorolac tromethamine 0 point 4 percent eye drops 5 ml , brimonidine tartrate 0 point 2 percent eye drops 5 ml , ctr nosule tension rings , microscope bulbs 15v 150w , moxifloxacin hcl 0 point 5 percent plus prednisolone 1 percent w v eye drop 5 ml , gatifloxacin hcl 0 point 3 percent plus prednisolone 1 percent w v eye drop 10 ml , malyugin ring , pva spears pkt of 10 , tropicamide 0 point 02 percent plus phenylephrine hcl 3 point 0 percent plus lidocain hcl 1 percent inj , iris hooks set of 5 , hydroxypropyl methycellulose hypermellose ups 3 gm carbomer 9802 point 2mg sorbitol dequest 2060 5slerile lubricant eye gel 10gm , fluriscein strip , acetazolamide 500mg tab , travoprost 0 point 004 percent with timolol 0 point 5 percent with polyquad 0 point 001 percent bottle with dispensing plug and screw cap eye drop bott of 2 point 5ml , tab tranexamic acid 250 mg , tab norethisterone 10mg , syp melatonin , ung betamethsone 0 point 64 mg plus salicylic acid 30 mg tube of 10 gm , syp metoclopramide 5mg ml bott of 60ml , doxepine 10mg cap , syp vitamin d3 drop 100 iu ml bott of 15ml , tab mycophenolate mofetil 750 mg , tab estradiol valerate 2mg pack of 28 , tab repaglinide 2mg , tab repaglinide 3mg , enterogermina bacillus clausii spores oral suspension 5 ml , tab estradiol hemihydrate 2 mg , syp risperidone2 ponit 5mg 5ml , tab bilastine 10 mg , ketotifen fumarate 0 point 005 percent eye drops 5 ml , atropine sulphate oint 1 percent tube of 3 gm , eye pad with patch , vitamin d3 400 iu ml drops 15ml , ether solvent , enema sodium phoshate ml 6 percent sod acid phoshate 16 percent pack of 100ml , calcium phosphate syrup 80 mg 5 ml 200 ml bottle , clotrimazole plus beclomethasone plus lignocaine plus chloramphenicol bott of 10 ml ear drop , pulv neomycin plus polymixin b bott 10gm , ung benzoyl peroxide 5 percent , tab repaglinide 1mg , inj methylcobalamine 500mcg , azithromycin 500mg inj , syp prednisolone 5 mg ml bott of 30 ml , levonorgestrel iu system , ung imiquimod 5 percent , bss ophthalmic irrigation solution 500 ml with unoport technology

Central Government/Public Sector

TRN :34278315 | 18 Apr, 2025

Tender Value : 0

Kanpur - Uttar Pradesh

Tender for gem bids for agno3 0.1 mol/l, silver nitrate solution, 0.1 mol/l (n/10) , buffer solution ph-7.0 , buffer solution ph4.0 , buffer solution ph-9 , ethenol , ammonia solution 25% , sodium thiosulphate std sol (n/10) , sulphuric acid std, solution, 1 n , edta 0.1 mol/l , sodium hydroxide std sol (n/10) , sodium hydroxide std sol (1 n) , silver nitrate , potasium iodide , disodium oxalate

Central Government/Public Sector

TRN :34278450 | 16 Apr, 2025

Tender Value : 0

Kangra - Himachal Pradesh

Tender for gem bids for potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g

Central Government/Public Sector

TRN :34245787 | 12 Apr, 2025

Tender Value : 4.50 Crore

New Delhi - Delhi

Tender for gem bids for lab automatin track system plus auto analyzer with pre analytic and post analytics , free t3 , free t4 , tsh , anti tpo , anti tg , thyroglobulin , vitamnin d3 , ipth , prolactin , total testosterone , shbg , cortisol , insulin , c peptide , estradiol , progesterone , psa , dheas , afp , cea , ca125 , ca19 9 , free psa , any other consumables as necessary for above parameter , glucose , urea , creatinine , calcium , phosphorus , uric acid , bilirubin total , bilibrubin direct , total protein , albumin , sgopt , sgpt , alkaline phosphate , ise sodium , ise potassium , ise chloride , amylase , csf protein , total cholesterol , hdl , ldl , triglyceride , lipase , iron , tibc , crp , cpk total , cpk mb , ldh , magnesium , ammonia , lactate , hba1c , phenytoin , valporic acid , carbamazepine , lithium , calibrator for all above parameters , serum contro normal for all above parameters , serum control path high value for all baove paramets , serum control path low value for all above parameters , urinary control normal , urinary control path , csf contro two level , wash solutions if required , buffer solutions if required

State Government

TRN :34247733 | 12 Apr, 2025

Tender Value : 0

Kangra - Himachal Pradesh

Tender for gem bids for oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.5percent cas 109-97-7 1 pack of 100ml , quinoline for synthesis 1 pack of 500ml , rosolic acid cas 603-45-2 , sabaourd dextrose agar , safety face shield tarson or polylab or axiva , scintillation vial polypropylene 20ml tarson or polylab or axiva , silicon oil for oil baths upto 250 degree celsius 1pack of 2.5l , silicon oil for oil baths upto 250 oc cas 63148-62-9 , sodium azide less than 99.5 percent cas 26628-22-8 , sodium borohydride 98.5percent cas 16940-66-2 , sodium chlorate 1pack of 100g , river sedimentbioavailable phosphorous standard bcr684-35g , sodium sulphate anhydrous cas no 7757826 238597- 500gm , stainless steel scoop 500gm capacity , stearic acid cas no 57-11-4 , succinic acid 99percent cas 110-15-6 , sulphur cas no 7704349 13825-1kg-r , sulphuric acid 98percent , tlc plates aluminium oxide coated with fluorescent indicator f254 1 pack of 20 units , tray , tris acetate phosphate cas no 77861 252859-500gm , universal ph indicator , utility tray polypylene 320x 260x70 tarson or polylab or axiva , utility tray polypylene 540x 435x 130 tarson or polylab or axiva , yeast extract peptone dextrose 79883-500g y1500 , zinc oxide cas no 1314-13-2 , zinc sulphate 7446-19-7 , hydrochloric acid 12 n cas number7647-01-0

Central Government/Public Sector

TRN :34240557 | 12 Apr, 2025

Tender Value : 0

Chennai - Tamil Nadu

Tender for gem bids for items for protein studies, 31 ml040 to 500ml 5x tris sds buffer ph 500ml ml039 to 500ml 2.5 x tris sds buffer ph 500ml 10x tris glycine sds gel running buffer acrylamide bisacrylamide solution 30 percent prestainer protein ladder 10ln bradford reagent 500ml tris free base 500gm hhimedia grm6365 to 500g di sodium hydrogen phosphate dihydrate potassium dihydrogen ml016 to 500ml 50 xtae used for gel electrophoresis ml013 to 500ml to 1m tris cl ph 8 ml123 to 1ktsilver staining kit lysozyme 5gm cms1889 to 1grifampicin 1gm ammonium sulphate 500 gm dodecyl sulphate sodium salt for mb 25gm parafilm m 2 x 250 1pk roll silver sulphate hi lr 25gm albumin bovine fraction v 5gm sd028-1vl penicillin g p 10units storage vials pp 10ml sterile 300 pk pack tarson glutaraldehyde solution 25 percent 25ml

Related Searched Keywords : ph buffer solution

List of ph buffer solution Tenders

Get ph buffer solution Tender Alert...

Related Searched Keywords : ph buffer solution

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us